Blastocladiella emersonii clone report

Clone ID BeE120N21E02
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N21E02
CGAGGAGCTGCTCGCCAACAAGGAGAAGCTCCTCGCCAACGGCGACAAGT
GGGAGGTCACCCTCGCCAACAACATCCGCAGCGAGCACGTCTACCGCTAA
GCGCGATATCGTGATGGCCGCGGCGGCGACGATCGCCGAACCCTCCTACC
TCTACCCTACCCACACCCCTATCCCTCCTCGCCCGGCTGCGCCTCGCCCA
AGGCTGGCCCTCTCCTCCTCCCCCCTCTGCACCTTGGTATACATGTGTTG
TGAACGTTT
    




The gene BeE120N21E02 is related to E120-NOR-21-E02-U.BIN ():

Sequence ID Image
E120-NOR-21-E02-U.BIN
No Image