Blastocladiella emersonii clone report

Clone ID BeE120N21B10
Best BLASTX Match ref|XP_568881.1|
Function Description cAMP-dependent protein kinase [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N21B10
CGGCGCCGGACCAAATGGCATGCAGGACATCAAGAACCACCCGTGGCTCC
GCGACCTGCCGTTCGACGCCATGATGAAGAAGGAGGCGACCGCGCCCTTC
ATCCCCGACGCAAAACGGCCCAACTTTGACGCGACGCACGAGCTCGAGGA
GCTGCTGCTCGAGGAGAACCCGCTCAAGCACAAGAAGCGGACGCAGCCCA
AGCCGGGGCAGCCGCAGCCGGCGCTGTCCAAGGAGATGCGGCTCATGGAG
GAGAAGTTCACCGTCTTCGACTACACCAAGCCCAAGAAGATGAAGGAGCG
CGAGCACGGCGAGCAGTCCTTCATCGACCTGCAGCCCATTGTGCGCGACG
ACGCGTCCATGGTCGCGTCCTCGAGCATGGCCTCGGACCACCCCGCGGGC
GCCGGGGGTGCCGCCGCCGCCCACGGCATCACGCCCGAACCGAGCGTG
    




The gene BeE120N21B10 is related to E120-NOR-21-B10-U.BIN ():

Sequence ID Image
E120-NOR-21-B10-U.BIN
No Image