Blastocladiella emersonii clone report

Clone ID BeE120N20H04
Best BLASTX Match ref|XP_629689.1|
Function Description putative protein serine/threonine kinase [Dictyostelium discoideum AX4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N20H04
GGCGGGCGGTGACAGCGCGCGCGCCGTGTCGTCGTGGTTCCTCAACGTGA
ACACGACGTCGGCCAAGCCGCCGCTCGAGATCTGCAAGGTGCCGCGTCTG
TCGCTGTTCGGGCTCCACTTCAAGCGCATCTCGGGCGGCATCTGGTCGTA
CAAGAAGCTGTGCAACAAGCTGCTCCAGCAGATGAACCTGTANGGGTCGG
GTGGTCNCTGATTGTGGTTGTGTGTGTGTCNTGTGTGATTCCTAGTTGCG
TTGTTATACAGTACTTGATCGAATAGCT
    




The gene BeE120N20H04 is related to E120-NOR-20-H04-U.BIN ():

Sequence ID Image
E120-NOR-20-H04-U.BIN
No Image