Blastocladiella emersonii clone report

Clone ID BeE120N19F08
Best BLASTX Match emb|CAG88719.1|
Function Description unnamed protein product [Debaryomyces hansenii CBS767]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N19F08
CAACCATGAATCTCATCGGCTCCATGCAATCGCGCGCCTTCCGCGCGCTG
TCGTCATCGGCGTCAGTGTCCGTCGCTCGTCGCGCCCTGACGACGACTCC
GGTGCTGCGGTTTGCGCGCCCGCCGCTCGAGAGCCCGATGAAGGCGCCCG
CGGGAGCCAACGGCAACAACACGGCGGAGCCGTCGACGGTCAAGTCGATG
CCGTCGCTCGCGTCGCAGACCGTGTCGCCGCTGGTCGCGTCCGAGTCGTC
CACGTTCCACATGGAGGCGGACGCGTTTGCCGGCATCGCGACACAGGCGT
TCCCCGACGCGGTGGTCGAGATCCTGCTCGCCGAGGTCGACCCGGCCGAC
ATTGAGATCAAGCCGGACGGTCTGCTGTACCTGCCCGAGATCAAGTACCG
TCGGATCCTGAACCGCGCCTTCAAGCCTGGCGGCTGGGCGCTGGCGCCGC
GCGGCCCGCACAGCATGGCGGGTCGCGTCATCAGCCGCGAGTACGCGCTG
TACGCGTACGGGCGGTTCATCTCGCAGGCGCGCGGCGAGCAGGAGGTGTT
TGACGAGAAGCAGCTGGCGACGGCCATGGAGGGGTGCAAGTCCAACGCGC
TGATGCGGTGCTGCAAGGACATTGGCATCGCG
    




The gene BeE120N19F08 is related to E120-NOR-19-F08-U.AB1 ():

Sequence ID Image
E120-NOR-19-F08-U.AB1
No Image