Blastocladiella emersonii clone report

Clone ID BeE120N19D08
Best BLASTX Match ref|XP_571768.1|
Function Description Acyl-coenzyme A oxidase I [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N19D08
CGCCCACACCGCGCACGCACCGCCGACTCGACGCACGCTCACCATGGACG
CAAAGCCCTACTACACGCCGCTCAACAAGGAGATGCAGTCGCTCGCCGAG
GAGCGCGTCAACCCGCGCTTCCCGGTCCGCGAGATGACCCACTTCCTCGA
CGGCAGTCCCGAGGCTACCGCGCTCAAGGAGAAGTTCATGCTCGACCTCG
AACGCGACCCGCTGTGGCGCATGGACGACTCGGCCAACCTGTCGCTGGCT
GAGGTCCGCGAGCGCACCATGGCCAAAAACCGCAGCATTCTCCACTACCT
CGCCAACGAGCCCGTGCACATCTTCCGCCAGCGCATGAACACCATCTCGC
TCGTCGACCCAGCCTACTGGACCCGTCTCGGCGTGCACTACGGCCTCTTC
TTCGGCGCCCTGCAGTCGCAGGCGACGTCCTCGCAGATGGCCTTCTGGGT
CTCCAAGGGCGCCCTGACCGTCAACGGCATGTACGGCTGCTTTGCCATGA
CCGAGCTCGGCCACGGCTCCTACGTCCAGGGCCTCGAGACGATCTCGACC
TTCGACGCTGCCTCGGACGAGTTCATCGTCCACACGCCTTCGATCACTGC
TTCGAAGTGGTGGATTTGCGGCGCCGCCCAGTCCGCGACACACGCGGCCG
TGTACGCGCAGCTGATCGTCACGGCAAGCGCCACGCGTC
    




The gene BeE120N19D08 is related to E120-NOR-19-D08-U.AB1 ():

Sequence ID Image
E120-NOR-19-D08-U.AB1
No Image