Blastocladiella emersonii clone report

Clone ID BeE120N19C06
Best BLASTX Match ref|XP_505989.1|
Function Description hypothetical protein [Yarrowia lipolytica]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N19C06
CGCTGCGCGAGATCTGCCTGCGGCTCGGGCTCGACTCGGAGGAGGACGCC
GAGTACATGGTGGCCAAGGCGATCCGTGACGGCGTGCTGACGGCGGTCGT
CGACCACGGCGCCGGCGTCGTGTCAAGCGCCGCGGCCGAGGCCGCCGCCG
ACGTGTACGCGTCGCGCGAGCCCCAGACGGCGTTCCACTCGCGCATCGCC
TTCTGCCTCGACCTGCACAACGCCAGCGTCAAGGCCATGCGGTACCCGGA
CCGGTCGGCGGTGCGCAACGCCGGCAAGGCGTTTGCCGACTCGGAGGAGG
TCCGGGAACTCGAGAAGGAGATCCAGCAGCACCTCGAGGACGAGGGCGAC
GAGTTCTGAGTTGGTTGGAGGTTGCGCGTGTGTGCGGGCGTGTTGTTGGA
CCGCGCGCACGGCGAGGATATATCGTTGCAGTGTTTTCTCGT
    




The gene BeE120N19C06 is related to E120-NOR-19-C06-U.AB1 ():

Sequence ID Image
E120-NOR-19-C06-U.AB1
No Image