Blastocladiella emersonii clone report

Clone ID BeE120N19B01
Best BLASTX Match emb|CAB93680.1|
Function Description plastidic phosphoglucomutase [Solanum tuberosum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N19B01
AGCGTGTCGACCAAGCAGGGCGTGTTCGCCGTGTTCGCCGACGGGTCGCG
CGTCGTGTTCCGCCTCTCGGGCACCGGGTCGCAGGGCGCCACGGTCCGCA
TGTACGTCGAGGCGTACGACGCGAACAAGACCAAGCTCGACCCGCAGGTC
GCCCTCAAGCCGCTCATCGACGCGGCGCTCGGCGTCGCTGAGCTCGAGAA
GTACACGGGCCGCAAGGAGCCGACCGTCATCACTTGAGCGAGCTCGAGTG
GGCGGGTGTGAGGGGGGAGCGCGTCGCGCAGCAGTTTGGTCGTTCATACA
TCTCATCGTTCTCTCGTG
    




The gene BeE120N19B01 is related to E120-NOR-19-B01-U.AB1 ():

Sequence ID Image
E120-NOR-19-B01-U.AB1
No Image