Blastocladiella emersonii clone report

Clone ID BeE120N19A08
Best BLASTX Match ref|NP_564704.2|
Function Description unknown protein [Arabidopsis thaliana]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N19A08
CGAAGCTCCTCGAGCGCTCTCATGGAAACTGCATGCAACACTCTCCCCGC
TCGGTGAACCACCCATGTCGGCCGTGAACCCGCACATTGGCGACATCCGC
GTGCTGGTGCGGCAGAAGCGGGTCGACGAGGCGCGCGACCTGCTGACGCG
GGCCGCGGCGCAGGTCGAGCCGCTGATGCGCAAGCGGTCGTGGAAGGTCG
GCAAGCTGCGCGAGTTCTTCCCGTCTGACAAGTGCCTGCTCGGCCTCAAC
ATCAACCGCGGCATGGAGGTCCGCGTGCGCCTGCGTCCCGCGCACAACCC
GGACTCGTTCTACGACTACGATTTTATCCTCGGCACGCTGCTGCACGAAC
TCGTCCACAACCGCATCGCGCCGCACAACGCCGCGTTCCAGGCACTCTTC
GAGGAGCTGTGGGACGAGGTGTTCGAGCTGCGGTCGCAAGGCTTCACGGG
CAACGGCTTCTTCTCGCAGGGCACGCGCGTCGGCCACGGCACCGGCGCCA
CCACGCTGCAGAGCGTCGCCGAGGCCAAGCGCGCTGCCGCTGCTGCCGCC
GAACGTCGCGGCGCCCTCGGGCTCGCGCAATCG
    




The gene BeE120N19A08 is related to E120-NOR-19-A08-U.AB1 ():

Sequence ID Image
E120-NOR-19-A08-U.AB1
No Image