Blastocladiella emersonii clone report

Clone ID BeE120N18F10
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N18F10
ATTATGACCCCACGAATCCGCGCACATACCCCTCCCTCCCTCGAGCAACG
TATCAAGCAGTATCACTACCACCACCATGAGCGCGTCTACGTCCGGCCGC
GACTTCACGCTGCTCGCGCTCGGCGCGAGCTTCATCATCGGGTTGCGGTT
CGTCGAGACCTCGGCCATCCAGGCGTACAAGAAGCCGTCCAAGTGGGCCT
ACTTCCAGCTCGCGGCTGCCGTCTTCCAGCTGCTCAACCAGTGCCTGTCG
GCGGCCATCCAGTGCGTCAGCGCGGCCTCGCTCGCCATGCCGTGCAACGC
GTGTCCTCCAGATCCCGACCACGGCGTACATCCTGTTCCAGCTCACGGCC
ACGAGCGTGCTCATCATGCGCAGCACGTGCATCGTGCCGACGACGTGGAG
CTTCCATGGTCGCCGCAACCCCGACGCTCGTCCCCTCGGCCGTCGGGCCC
GACGGGAAGCCCGTGGCCACGCCGCAGACGGGCCGGCGCCGGTCCTCGCT
CGTCGACAACTCGGCGC
    




The gene BeE120N18F10 is related to E120-NOR-18-F10-U.BIN ():

Sequence ID Image
E120-NOR-18-F10-U.BIN
No Image