Blastocladiella emersonii clone report

Clone ID BeE120N18B10
Best BLASTX Match ref|XP_569081.1|
Function Description glycogen synthase kinase 3 [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N18B10
CACGGGCGTCCTCAAACTGTGCGACTTTGGCTCCGTCAAGATCCTCATTG
CCGGCGAGCCCAAAGTGTCCTACATCTGCTCGCGCTACTACCGCGCCCCG
G
    




The gene BeE120N18B10 is related to E120-NOR-18-B10-U.BIN ():

Sequence ID Image
E120-NOR-18-B10-U.BIN
No Image