Blastocladiella emersonii clone report

Clone ID BeE120N10H08
Best BLASTX Match ref|ZP_01425027.1|
Function Description conserved hypothetical protein [Herpetosiphon aurantiacus ATCC 23779]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N10H08
TCCGGTCCGGAATCCCGGGTCGACCCACGCGTGCGCTCCCGCTCCCGAAG
CAACCGACCGCAAAACCATGGATATCACAAACAACTTGGAGGACCGCCTG
CCGCGGGTGTGTCGGCGCGCCGCTCATCCGCGTCGTCAACCTCGTCATGC
TCATCGCCGTGTTCGTCGTCAACGGGCTCGCCAACACGACGCTCTACAAC
GGCGTCCGCACCAACGAGGTGTCGGACGCACTGCCCAACTACTTTGTGCC
CGCGGGCTACGCCTTCAGTATCTGGGGCATCATCTACATGTGTCCTCGCG
GCGTGGGGCATCTACCAGATCCTGCCGCGGTCGTACGACTCGGCGATGCT
CAACGACGCGGTCGGGTGGGTGTGTCCCCGTCAACGCGGCGCTCAACATG
AGCTGGATCGTGCTGTGGGCGTACGGCCAGAAG
    




The gene BeE120N10H08 is related to E120-NOR-10-H08-U.BIN ():

Sequence ID Image
E120-NOR-10-H08-U.BIN
No Image