Blastocladiella emersonii clone report

Clone ID BeE120N10E04
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N10E04
GAGGCACCTGCTTGCTGTACTTCCAGCGACGCTCCGCAGTCTTGACCTGT
CGAGCATTGATCCCAGCCCTGCGATTCTGCGCTTGCTTTCGCGCAGTCTA
CCTGCTGGGCTTGAGCGGCTCACCCTCATGCGTGTGGGCTTGGACCCCAA
TGTCGCCGCGTACATGCTCCGCCGGCTGCCGCGAACGCTTCGCCATCTCA
ATCTCGCCAGTAACCACATTGACATACGCGCGATTCGCGTGCTTGAGCAG
TGCATGCCAGCCAACCTTGAATCGCTCCACCTGAAGGGCACGGTGCTGGA
TGACGATGCCGTCGCCCTTCTCGCCCCCGCGTGGCCCACCACTTTGCGCT
CACTCAACCTCTCCGTGAATCCCATCACGGACGACGGCGCGCTTGCACTT
GCGCAGCATCTGCCGCCGGCCCTCGAAGAGCTTCTTATGCAACAGACCGC
GATCACGAACGAAGACGGGGAAGCGGCAATTCGATCGTCTGAGCCCGGAT
CGATCACCAACTTGCAACTTTTGTGCCGACTCGTGCCCTACAACGGTTTC
GAATCTGAACCTGAGTCAGAGTCCGAATTTGACAAATCTGACAAAGAAGA
ATGGCAAGGGTTGGAATTCGATGGGTCCAATGGGAATGATTCAATGGCTG
GTTGGATGAATTGATGCCATATCAATTTACGGGACCTTCGTGAAC
    




The gene BeE120N10E04 is related to E120-NOR-10-E04-U.BIN ():

Sequence ID Image
E120-NOR-10-E04-U.BIN
No Image