Blastocladiella emersonii clone report

Clone ID BeE120N09G10
Best BLASTX Match gb|EAA01611.2|
Function Description ENSANGP00000004127 [Anopheles gambiae str. PEST]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N09G10
CTCGCATGTAACTTGAGCTCCTCGAGGACGGCAACACCCACTGCAACGGA
ACACACACATGTCAAATCCACCGTCGCCCCCAAGGCAGATCGGCGATGAC
GACGACGGGCTCGGCGCGCTCGCCGACAGCTTCGATCTCGACACGCAGGC
GCTCGACGCGCTCGCCGAGTTTGACACGCAGGACTCGCGACGAGTTCCCC
GACGACAGCCGGGAACCCACGCTCGGGACGACGCTCGGGACCGCGTCAGG
CACCGCCGGCGGCATTGGCAACCCGCTCGACGACGAGGCGGGCGACGACG
ACGGGTCGCCAGACCTGGACGTGCTGACGAAAGCGTGGGTGAACGAGCGG
TTCGCGCCCGAGCTGCTGCCGTTCCAGCACGCGGCGGTCGAGAACCTGAC
GGAGCTGCTGTCGTACCAGGCGTCGGACCTGGCCGAGGGCGCGGCGGACC
TGGCGCAGATCATCAAGGCCATGGACGTGGAGCGCGTCAAGTTTGTCCTG
CGCAGCTACCTGCGCACGCGCCTGCACAAGATCGAGCACGTCGCGCTGTT
CCTCATGGCGCCCGA
    




The gene BeE120N09G10 is related to E120-NOR-09-G10-U.BIN ():

Sequence ID Image
E120-NOR-09-G10-U.BIN
No Image