Blastocladiella emersonii clone report

Clone ID BeE120N09E05
Best BLASTX Match gb|AAW45976.1|
Function Description hypothetical protein CNJ01150 [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N09E05
CTTCTTCCACATCCTGATCCATCACGGGTCGACGATCGCCGAGTGGCGCG
CGGCCAAGTACCACGAGCAGGAGAGCTACGCCAACTTCCGCGCGCTGCTC
GAGGCGCCCGTGGCCGACGCGCGCGCGCTGCTGGCGGACCGGTTCCCCGT
GCCGCGGTACGTGGACTGCAACCAGAACTCGTCGCAGGCGCGGTTCCTGC
TGGCCAAGCTCAATCCGTCGATGACGTACATGTCGGGGATGCAGTACGGC
GCGCAGTAGGGGCAGGCCATCTTCACGGACGACGTGTCGCTGCAGGTATT
CATGGACCATCTCAAGCGATTGGCCGTGTCGGGCAACGCCTAGGATGGTT
GCCGCATCTCTGTAGTATCCCGATTGCTGTTATTCCTCATCTCTCGTTCG
TTATTTGATCCCCCTCGTTTTTTCCTCG
    




The gene BeE120N09E05 is related to E120-NOR-09-E05-U.BIN ():

Sequence ID Image
E120-NOR-09-E05-U.BIN
No Image