Blastocladiella emersonii clone report

Clone ID BeE120N08H10
Best BLASTX Match emb|CAB54828.1|
Function Description rpl30-2 [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N08H10
GTCTCTTATAGTTTCTGGGGGCGTCAAGCACCCCCTACATCATCACCCTG
TCGGCCATCAGCAACAAGACCAAGAAGTCCTCTGACAACATCAAATCTCA
ACTCGCGCTGGTGATGAAGTCGGGCAAGTACTCGCTCGGCTTCAAATCGA
CGCTCAAGGCCATCCGCAACGGCAAGGCCAAGCTCGTCATCCTCTCGGGC
AAATGGCCCCCGCTCCGCAAGTCCGAAATCGAGTACTACGCCATGCTCTC
CAATAACTTTGTTCACCACTACTCGGGCAACAACATCGAGCTCGGCACCG
CTTGCGGTAAGCTCTTCCGCGTTGGCGTCCTCGTCATCACCGACGCCGGT
GACTCGGACATCATCAAACAACAAGGGCTAAGCGGGCGCCTCCCCGTCGG
GCTCCGTGTGTGATCCGTAACTGTAATAAATTCTCGAACGGGTACCTCTC
C
    




The gene BeE120N08H10 is related to E120-NOR-08-H10-U.BIN ():

Sequence ID Image
E120-NOR-08-H10-U.BIN
No Image