Blastocladiella emersonii clone report

Clone ID BeE120N08C01
Best BLASTX Match ref|XP_001070194.1|
Function Description PREDICTED: similar to Y38F2AL.2 [Rattus norvegicus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N08C01
CGTAACTTGACGTCACCACCGTCATGGCCGAGCTCCATCTCATCGGCACT
CTGCAGGGCGCACAGGTTCGCGAAGCTGGGCAGCTCACTGGCGGGGCCGG
CCTCGCGTGCCGGTGGACCGTGGTCAGTGGCACGCAGTGGAACACGGTCG
AGGGCTGCTCGACTGCACAGACGCACGTCGACCTGCCCGCGGACGGCGAG
TGGGTTGTGTGGTCGCACCCGATCGACCTTCATCTCGCGACGCGCTCGGT
GCAGGGCTGGCCCAAGCTTGCCGTCGAGCTGCTGCGCCAGGACATGTTTG
GACGATACCAACTCATCGGATACGGCATCGTGAGCATCCCCATGACGCCC
GGGACACATCAGCTCGAGTGCCCGACGT
    




The gene BeE120N08C01 is related to E120-NOR-08-C01-U.BIN ():

Sequence ID Image
E120-NOR-08-C01-U.BIN
No Image