Blastocladiella emersonii clone report

Clone ID BeE120N08B01
Best BLASTX Match gb|EAS33907.1|
Function Description hypothetical protein CIMG_04931 [Coccidioides immitis RS]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N08B01
TCGTGCAGGTCAACCAAATCCACGAGAAGAAGCCGACCCATGTCAAAACC
TTCGGCATCTGGCTCCGATACGACTCGCGCTCGGGCACCCACAACATGTA
CAAGGAGTACCCGAGAGCTGACCCACACCGACGCAGTCTTCGCGTGCTAC
CAAGACATGGATGCCCGCCAACGTGCCCGCTTACGCTCGGTCCAGATCAT
ACAAGTTCACGAAGTCCCCACCAAAGACGTTCGCCGGCCCTAAATCCAAC
AAGATTCTTGTACCAAAAAACCATCAAGTTCCACCATGTCCCACAACAGG
GTTCAAGCAGCGACCGGACTCCAAAGCGGCCACACGAAATTCAGCTTCAT
TAAAATCGACCCAAATCAGCCCCACTTCGAAACAAAAAGGCCCTCTAAAA
TGGGGGCTTCCCGAAAAACGGGGATGAACCCTTAGAGGTTGGGTAGGGGG
ATACCAAGTACTATTCCCGAGAGACCTTCAACCGTTTGTCTGGGCATGAG
AGGGATTTCTTCAGCTATCTGTGGAACACAGGGGGTTTGTCATTGACCGT
TATCCTTCAAAACCCGAAAATGAGGGTTGGTGTCCCCACGGCCACCATTC
GGGGGCAAACCACAATAAATCGAATTGGTTACTTTTGAACAG
    




The gene BeE120N08B01 is related to E120-NOR-08-B01-U.BIN ():

Sequence ID Image
E120-NOR-08-B01-U.BIN
No Image