Blastocladiella emersonii clone report

Clone ID BeE120N07G04
Best BLASTX Match ref|XP_370377.1|
Function Description hypothetical protein MG06874.4 [Magnaporthe grisea 70-15]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N07G04
GGATGAACTGCCTGCTGATGCGCGAGGTCACGCACGCGGCCACGATCCGC
ATGTGGGACGCGTACCTGTCCGAGGACGGCGACCTCAACGACTTTCACGT
CTACGTCTGCGCCGCGTTCCTCGTCAAGTGGTCCAAGGAGCTCCGCGCCA
AGGACTTTCCGGAAATCATGCTCTTTCTCCAGTCGCCGCCGACCAAGGAG
TGGACCGACAAGGATATCGAGCTGCTCCTGTCCGAGGCCTTCATGTGGAA
GTCCCTGTTCCACAACTCGCCAAATCACCTCGCCGCCAAGTGACGCCGCC
GTCGCGTCCGACGCCGCCATACCCTCTTCCCGTCCGCGCCGCGCTGCCGC
TGCCGGTCCCGCCAACGGCGGCCGACGCGGCGCATGTACTACCCACCCGG
CCACCGTCACCGCTCCTCCACCGTCATTGTTCGCTGCTGCTGCTCATAGA
TCTACATNTTGCCCTTTCC
    




The gene BeE120N07G04 is related to E120-NOR-07-G04-U.BIN ():

Sequence ID Image
E120-NOR-07-G04-U.BIN
No Image