Blastocladiella emersonii clone report

Clone ID BeE120N07F06
Best BLASTX Match ref|XP_758910.1|
Function Description hypothetical protein UM02763.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N07F06
GTGCTGGATCCTGACGGGCGTGGTGGTCGCGTCGAACGCGGCGCGCCGGT
GGATCCTGCCCAAGGCGGTCCACGCGTGGCTGCCGCACTGGAACGCGGTC
GGCGTGTCGATGCTCACGTCGCGCATGGATTTCGCGCTCGCCACGTTCGT
CGGCGCCGTCGCGTCGAGCTACTGGGCGCGCCGCAGCCCGCGCAGCTACG
AGATCCTCATGTTCACGGTCGCGTCCGGGCTGATTGCGGGCGAGGGACTG
TGGGGGCTGTTTGCCGCGCTGTGCAACATTGCCGGGATCCCCGAGGGTTG
GCTGTCGCGCGCCGGCCTCCCGCGCTAATGTTCGAGAAGATTTCCTCATT
ACTCGCTAGACTCGCTAGAATTAAAACCCGCTTGACGCGTTGCGCCNN
    




The gene BeE120N07F06 is related to E120-NOR-07-F06-U.BIN ():

Sequence ID Image
E120-NOR-07-F06-U.BIN
No Image