Blastocladiella emersonii clone report

Clone ID BeE120N07E11
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N07E11
AGCTGGTAGCCTGCAGTACGGTCCGGAATCCCGGGTCGATCCACGCGTGC
GCCTCATCGCGCTGCGCTCCCTGTACGAGTACGAGTACAAGACGTCGTTG
CGCAAGCACCAGGAGGGCCTTGACCAGGAGCAGCTCGAAATCATCGCCAA
GGCCATGACCGAGCTCGGTCTGCTCGAGGATCCCGATGCGCTCGACGAGA
CGTCCGAGGTGAGCGACGAGGTCGTGGCCGAGATCATCAAGGAGGCCGAG
ACGGTCCCGCACTTCGTGATCTCGCGCAGTCGCTCGTCCTCGGCGACTCT
CGACGCCAACTTCCTCATCACGCTGGCAGACATCCCCATGGACTACACGC
TCGAGGACATTGACAAGCTCATCCCGCACGCCTCGGCGTTCATCTCGACC
AACCCGACCGAGGACGAGTCGGACGACTCGGTCGTGGTCATGGACGACGA
CGACCTCGATGCCATGCTTGCAACGGCCTCGTCGCTCCATGGGCGCTTCT
GATCGGTCTCCGAAACTCGTGGTGTATTCATTTGTCATTGATCTATCCGT
TCTGTACG
    




The gene BeE120N07E11 is related to E120-NOR-07-E11-U.BIN ():

Sequence ID Image
E120-NOR-07-E11-U.BIN
No Image