Blastocladiella emersonii clone report

Clone ID BeE120N06E01
Best BLASTX Match gb|AAI09911.1|
Function Description Similar to dynein 2 light intermediate chain isoform 1 [Bos taurus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N06E01
AGCAAGTTGACGGCCGTTGGGCCCAAGGACCTGTGGACCATCATGAAGGA
GGAGGGCGCCGCCGTTCGAGCGTCTGAGGGGTTCGATCTCCAGTCTGGCT
CGGAGACATCCATCATGTTCCTCGGCCAAAAATCGAGCGGCAAGTCGAGC
ATCATTCACCGATTCCTGGACAAGAGCGACGTGCCGAGCGCTACGGTCGG
TCTCGAGTACACGTATGGTCGCCGCACAAGGGCGACAACCAACGTCAAGG
ACGTGTCGCACATCTGGGACCTCGGCGGCGGCACGCACATGACCAAGCTG
CTCCAGGTTCCGCTCACGGCCGGGAACGTGCACACGGCCGCCGCGGTCGT
GTGCGTTGACCTGTCCCGGCCTCGAGAGCTCGTTGCCGCCATGGAGCACT
TTGTCACGGCGCTGGCGATGCGGGTGGAGGAGATTCTGGGTGGTCTCGAG
AAGCGCGGGTCGAAGCGGCCCAAGGGCCTGCGCGCATTCGCAGCGAAGCG
GTACGGCGGCGACCACCCCGACCGCGCTACGCTCAAGCTGATCCCAGTGA
CGTGGGCGCTGGTGTGCACCAAGTACGAAGCGTTCCGCGACCAGCCCAGC
GAGCT
    




The gene BeE120N06E01 is related to E120-NOR-06-E01-U.BIN ():

Sequence ID Image
E120-NOR-06-E01-U.BIN
No Image