Blastocladiella emersonii clone report

Clone ID BeE120N06D04
Best BLASTX Match gb|AAO24535.1|
Function Description At5g58240 [Arabidopsis thaliana]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N06D04
GTGGACGATCCCCGCCGGCGAGGTGTTCCTCGTCACGCGGCTGTCGTACG
CCATGGTCAACTTCAAGCCGATCCTGCCCGGCCACGTCCTCGTCTGCCCG
CGCCGCCTGGCACCTCGCTTCTCGGACCTGACGTCAGACGAGGTGACGGA
CCTGTGGCTGACCGCTCAAACCGTGGGCCGCGTCGTCGAGCGCGAGTACG
AGGGCTCGTCGCTGACGTTCTCGGTGCAGGACGGCGTGGCCGCGGGGCAG
ACGGTGCACCACGTTCACATCCACGTCATCCCGCGCCGCGCGGGCGATTT
CGAGAACAACGACGATATCTACACGGCGATCGAGGGGCACGAGAAGGCGA
GTGCCGGGGTTCTCGAGAAGAAGGCGGCCCCGCCGATGGATAACGAGGAG
CGTCCGCCCCGCACGCTCGAGGATATGATGGCCGAGGCCAAGGCGCTCCG
CGGCTTCTTTGAGCAGTTTGAGTCGCTCGACTAGACGAATACATGGTCGT
GTCAGCTTGAAAAAAAAACCACAG
    




The gene BeE120N06D04 is related to E120-NOR-06-D04-U.BIN ():

Sequence ID Image
E120-NOR-06-D04-U.BIN
No Image