Blastocladiella emersonii clone report

Clone ID BeE120N06D01
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N06D01
CCAAGGTGCGCCGCCGCCTCAACGAGCACCGTCTCGAGATGGACAAGCGA
GCACGGTCGCGCGAGCGGCTCAACGGAAGGGGTTCGCGGGTGTGAATAGA
CGCGGGTGGTGGATC
    




The gene BeE120N06D01 is related to E120-NOR-06-D01-U.BIN ():

Sequence ID Image
E120-NOR-06-D01-U.BIN
No Image