Blastocladiella emersonii clone report

Clone ID BeE120N06B11
Best BLASTX Match ref|XP_762052.1|
Function Description hypothetical protein UM05905.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N06B11
GACGTACGGGTTCGTGGTGACGGCGTTCCGCGGCGCGCAGGAGGTGGCCG
TCAAGTTCATTTTCAAGGACAAGATCCCCGTCACGGCGTGGATGAAGGAC
GCGACGTACGGCATGGTGCCGTCCGAGATCTTCTTCCTCAAGAACCTGTC
GCACCCGAACATGGTCAAGCTCATCGACTGCTTCGAGGACGAAAAGTACA
TCATGGCCATCACCGAGCTCCACGGCACCAGCTGGGACGCGGCCAACCCG
GTGCTCCAGGCCGGCATCGAGCGCGAGGGACTGCGCAAGGTGCCGCGCGC
GCAGCGCGTCGGGTCCGAGGGCAAGGGCGACCTCAACACGCTCTCGAGCC
TCAGCTCTAAGCAGCGCGAGATGCTCCGCCCGCGCGTCAGCTGCGACCTG
TTCGAGTGCATCGATGCCCACGACTACTTCCCCGAGGGCGTCGTGCGGTT
CATCTTCCGCCAGGTCGTCGAGGTCGTGTCGTACATGCACGACAACGGCG
TCGTCCACCGCGACCTCAAGGACGAGAACATTGTGATCGACGAGAACTAC
GTGATTAAGCTGATTGACTTCGGTTCGGCGGGGTACATTCCGCCGTCG
    




The gene BeE120N06B11 is related to E120-NOR-06-B11-U.BIN ():

Sequence ID Image
E120-NOR-06-B11-U.BIN
No Image