Blastocladiella emersonii clone report

Clone ID BeE120N05H04
Best BLASTX Match ref|XP_635160.1|
Function Description G-protein-coupled receptor (GPCR) family protein [Dictyostelium discoideum AX4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N05H04
TCCGGTGTCAGGCGAGCCTCTGGATCTTCGCGTACGGGTTCCAGATGGTC
GTGGGCGCCACCGTGGCCAAGGCGTACCGCATCTGGACAATTTTCGAGAA
CAAGTCACTCGTCAAGGTGACGCGCGTCAGCGACCGCGCGCTGTTCCAGG
GCGTGGGCGCCATCATGCTCGCGCAGTCCGTGATCCTGCTAGTGTGGTCG
ATCGTCGACGCGCCCAAGCCGCAGATGACGTCCGCGCGTACCTACATCTA
CTACGCGTGCCGCAGTGAGTCGCCGACCTTCCAGAATGCGCTCACAGCCA
CCTCGATCGCCTTCAACGCGCTCCTGACGCTCGTGTTCCTGTACCTCGCC
TTCAAGACGCGCAACGTTAGCTCGTCGTACAACGAGTCCAAGTTCATGTA
CCTCGCGGGACAGAACGATTGCGCTGTCGTTCATCGTG
    




The gene BeE120N05H04 is related to E120-NOR-05-H04-U.BIN ():

Sequence ID Image
E120-NOR-05-H04-U.BIN
No Image