Blastocladiella emersonii clone report

Clone ID BeE120N05B08
Best BLASTX Match emb|CAB40843.1|
Function Description phytoene dehydrogenase [Mucor circinelloides f. lusitanicus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N05B08
CCAACTACCGGCTGCACTTCCACGACGGCGACACGCTCGAGCTGTCGAGC
GACCTGGCGCACCTGCGCAAGCAGCTTGACCGCTACGAGCCGGGCGCCTA
CGAGCAGTTCTTCAAGTTCCAGCGCGAGTCGCACGTCCACTACGAGCTGT
CCGTGGCCAAGGTCCTGCGCAAGAACTTTGTCAAGTTCACCGACTTCTTT
AACCTCGCCAACGCCAAGATGGCGCTCTCGCTCAACCTGCACTCGTCGCT
GTACGGCCGCGTCGCCTCCTACTTCAAGAACGACAAGCTGCGCAAGGCCT
TCACCTTCCAGGCCATGTACATGGGCATGAGCCCCTACGACGCCCCCGCC
ACCTACTCGCTGCTCCAGTACACCGAGTTCGCCGAGGGCATCTGGTACCC
CAAGGGCGGCTTCCACCAGGTCGTCGACCGCCTCGAGGCCGTCGCCAAGT
CGCGCGGCGCCACCTTCCACTACGGAAAGGGCGTCGC
    




The gene BeE120N05B08 is related to E120-NOR-05-B08-U.BIN ():

Sequence ID Image
E120-NOR-05-B08-U.BIN
No Image