Blastocladiella emersonii clone report

Clone ID BeE120N04G05
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N04G05
TGACGCAGTTGGCGGCGCCCGCACAAGGTCCAGCGACTCTCGCTCCATCA
AGCGGCCCAGCCGCGTCCGAGGCTGAGCCGGTGCGGGCTGCCACAGCAAC
AGCCCCATCACTCGCACGCCAGCCGAGCGAGACGGCGATCCTGGCGCCGC
TGCCCGTGATCGAGCCACGTCGCGGACGCGATTCGCAGGCGCTGATCCTG
CACCCGAAGCGGCGCGGGCGGTCGGTGCCGCCGACGGGCATGGGCCTGTC
GGGCGAGCTGCTGCGGCGGACGCTCATGATCCCGACGACGCCAGTGCCGC
GGTGGCGCCAGGCATCGCTCGGGGCCAAGGTGTAGGCGAGCGAGAAGGTC
ACGAACCACGTAGTCTATTTGGTTGTTGTTTAGAATGAAGCAGCGTAAGA
TCC
    




The gene BeE120N04G05 is related to E120-NOR-04-G05-U.BIN ():

Sequence ID Image
E120-NOR-04-G05-U.BIN
No Image