Blastocladiella emersonii clone report

Clone ID BeE120N04F11
Best BLASTX Match ref|XP_762450.1|
Function Description hypothetical protein UM06303.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N04F11
CCCACTCGTGCGGCAACGTATCGACTTCTTGAAACCATGACCACGTCCAA
GTCGCAGGAGGCCGCCGCCGGGTCGTCGAACCAGGCCGTCAAGGAGATTC
TCGCCGGCAGCTTCGGCGGTGTCTGCCAAGTTCTCTCGGGCCAGCCGTTC
GACACGATCAAAGTGCGCCTGCAAACCCAGCCCACGCCGCCCATCTACTC
TGGCGTGGTGGACTGCGTCAAGAAGACGGTGCAGGCTGACGGTGCGCTGG
GCCTGTACAAGGGCACCGTGACCCCGCTGCTGGGCATCGGCGCGTGCGTG
TCGATCCAGTTTGCCGTGCTCGAGAACATGAAGCGGCGGTTCGCCGCGTC
CAACGGCGGGTCGACGGACCTCTCGCTCGCGCAGCTGTACATGGCGGGCG
CCGTGTCCGGCGTCCCCAACAGTGCCGTGTCGGGCCCCGGTCGAGCACAT
CCGCACGCGGATGCAGGTGCAGACGGGCTCCAACG
    




The gene BeE120N04F11 is related to E120-NOR-04-F11-U.BIN ():

Sequence ID Image
E120-NOR-04-F11-U.BIN
No Image