Blastocladiella emersonii clone report

Clone ID BeE120N04B04
Best BLASTX Match ref|XP_517512.1|
Function Description PREDICTED: Rap guanine nucleotide exchange factor (GEF) 2 [Pan troglodytes]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N04B04
CAAGAACGACCTCGAGTCGTTCCTCGCCGAGCTGTGCCAGTTTGGCCAGT
TCCGCGAGCTGTCGCTGGCCATCCAGGACATTATCGAGCGCAAGACGGAA
GAGTACGAGCGGGTGATTGGCGAGTACAAGCTGGCGTCGCAAAAGTCCAA
GACCATGGAGTCCATGATCATGGCGTACACGCCGCTGCAGGTCGCGCAGC
AGCTGTGCGTCTACAACTGGCGCCTGTTCCGCAACATCCACCCGATCGAG
TATCTGAACCAAATCTGGGTCAAGAACCGCGACGAGGACAGCATGTCGCC
GAGTCTCGACTACTTCATCTCGCGGTTCGACGTGGAAAGCTACTGGGTCG
CGACCGAGGTGTGCATGGTCAAGGACATGAAGAAGCGGGCAGCGGTCCTG
ACGCAGTTCATCGAGATCGCCAAGCACTGCCTCGACATGAACAACTTCTT
CACGACCTTCTCCATCTTCTTCGGCCTCAACATGGGTCCCGTCGAGCGGC
TCAAGAAGACGTGGAAGCTGCTCACGCCCGACACGCAGTCCAAGTTCGAG
GAGGTGTCCAAGTTCTGCGACGCGAGCCGGAACATGAAGA
    




The gene BeE120N04B04 is related to E120-NOR-04-B04-U.BIN ():

Sequence ID Image
E120-NOR-04-B04-U.BIN
No Image