Blastocladiella emersonii clone report

Clone ID BeE120N04B01
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N04B01
CGCGTGCCACACCGAGGCTAAAGAGAGAGTCGCTTCCAAAGACGGTGTGG
TGCCGCCGTTTGACGAGCTGACTCGTGGCTCCCGCGTCTACTTTGCGCCG
CAAGCGCCCAAGCCCAAGTCGCCCGAGCTGCAGCGCATTCTGGACGCTAT
CCGCGCCGAGCAGGAAGAGTTCGAGTACGAGCGCATGACCGGCCGCCGCC
TCATCGACAGCAAACTCGCGTTGCCCGATGCGGCGCAGCTCGCTGGGGAC
CCCAAGGCCGTATCAAAGGTTCTGATCGGGTCCTTCAACGTCTTCTTCAC
CGCCGCGTCCGTCTTTGTGGCCGTCATGTGGATCGGGCCGACCATCTCGG
ACAACGTCGCCTGGCGCGTCATGGCCGCATTCAGCCTCGCCATGATCATC
CTCGCCGGCGAGGGGTGGCTCGCGTACCGTAGCGCCTTTCAGCGAAAAAT
GGAGTAACTTACTCAC
    




The gene BeE120N04B01 is related to E120-NOR-04-B01-U.BIN ():

Sequence ID Image
E120-NOR-04-B01-U.BIN
No Image