Blastocladiella emersonii clone report

Clone ID BeE120N03H02
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N03H02
GGCCGACGATGCGGTCCTGTTCACGATCCCGAGCACGACGACCGTGGTCC
TCCCTCAAGATGGCGGCGGTGCGGGCGACAACCTCGAGCCGCACCCGGCG
CTCGCCGGGTTCCACTACACGATCGAGGGGCTCGACGAAGCCGACGACGG
GACGTGGCGCGGGCGCGTGCGGCGCGCGTTCCGCAACGGGAACAACGTGC
TCAAGATCACGCTCGTCGCGTATGTGGTCGCCGGGTCGCTGCTCGTCAAG
TTCGTCGTCCCCGAGAACCTCGTGTACCTCGTCACGTTCCTCCTCGTGTT
CGTCCTGTGCTTCTTCCTCGTGTTCTTTGTCGAGTGCGAGATCTGACGAG
CGGCGTAACATTTGATGGGAAGATGATGTTGGGCCGGAATGGAAACCGTT
TGTG
    




The gene BeE120N03H02 is related to E120-NOR-03-H02-U.BIN ():

Sequence ID Image
E120-NOR-03-H02-U.BIN
No Image