Blastocladiella emersonii clone report

Clone ID BeE120N03G03
Best BLASTX Match ref|XP_789541.1|
Function Description PREDICTED: similar to RAB28, member RAS oncogene family, partial [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N03G03
GAAAGCGTAACTCCATGAAACGATAATGAGGGACTTTCCGCGCGTCGTCA
AGATCTGCCTGGTGGGCAACCCGAGCACGGGCAAGTCGAGCCTGGTGCAC
CGGTTCGTGTACGACCGGTTCTCGGTGCACTACCAGCCGACGACGGGGCT
CGAGGTGTACGAGAAGGCGACCAAGCTGTCGGACAACGCGCCGTGCGTCG
TGCAGATCTGGGACATCTCCGGATCCATGCTGCACGCGCGCGGCCTGCCC
AACGCCCTCGTCGACGCCGACGCCGTCCTCCTCGTCTACGACACCACGCA
GCCCGCGAGCTTCAAGTCCGTCCAGCAGTGGCTCCAGCTCGTCGAGCGCG
TGTGCGGCGACGGCGCGGGGACCGAGCCCGAGATGAGCGGCGGCGGAGGC
GGCGAGCTTGCGGGACTCGGTAGTTCCGACGCGCCGCACAAGCACAAGCG
GCGGTCGGCCAAGTCGCGGATCCCGCTCGTGGCCATGGTCGGGACCAAGT
CGGACCTGGCGGGCCTGCGCATGGTGTCGCCGCAGATCCACTTGCAGTTT
GCCGAGGAGCACGACCTGCTGCAGTACACGGTGTCGGGGCGCGTGGCCG
    




The gene BeE120N03G03 is related to E120-NOR-03-G03-U.BIN ():

Sequence ID Image
E120-NOR-03-G03-U.BIN
No Image