Blastocladiella emersonii clone report

Clone ID BeE120N03F08
Best BLASTX Match ref|NP_998882.1|
Function Description hypothetical protein LOC407955 [Xenopus tropicalis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N03F08
ATCATCATCATCGCCACACTCGGAAAAACTACGGATCAAGCACTTCGTCG
AGAATGAGCCACCCGGACTCCCACCACGCCGCCATGGCGGCCACGGGGAC
GTGCATCTGCAAGCTGTGCGACTGCGGCAAGCACCGGTGCGGTCGGCCCG
CGCTGCCGACGGTCGGCATGCCCATGGACTCGGCGACCGAGTACAAGGAC
CGGTTCCCGGCACACCCGCTGCAGTACGCGGGCAAGAAGAAGCCGCCGCC
GCACGTGGCCGGGTCGCACGCGCCCATGAGCAGCATGACCGAGAACCGCG
AGCAGTTCACGCCCAAGGCGGTCCCCGAGCGCTTCAAGCCCGCCAAGCGC
GAGTACCACCCGAACCTGGCCGCGCTCGAGGCCACCACGGGGTACATGGC
CGACTACCAGCGGAGGAAGGACGCGCCGCCGCGCGAGTCGTCCAAGAAGC
CCCGAGGTGTACCGGGCCGTCGGGCGCC
    




The gene BeE120N03F08 is related to E120-NOR-03-F08-U.BIN ():

Sequence ID Image
E120-NOR-03-F08-U.BIN
No Image