Blastocladiella emersonii clone report

Clone ID BeE120N03E01
Best BLASTX Match ref|ZP_01114902.1|
Function Description D-lactate dehydrogenase [Reinekea sp. MED297]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N03E01
AGATGGTGGCCTACCGGTGCGCCGGCTTCGACACGTGCCACGTCCCGACG
TGCGACAAGCTCGGCATCTCGGTCGCGCGCGTCCCCGGGTACTCGCCCAA
CGCGATCGCCGAGCACGCGGCGGCGCTCATGATGGCGCTCAACCGCAAGC
TCGTGTGGGCGTCGTCGCGCGTCCACAACGGCGACTTCTCGCTCGATGGG
CTCGTCGGGTTCGACATGAAGGGCAAGACGGTCGGCATCATCGGCACGGG
CAAGATCGGCGCGTGCCTCGTGTCGATCATGCTGGGCTTCGGGTGCCGCG
TCATCTGCCAGGACGTGTACAAGAACCCGGCGCTGCTCGCCAACCCGCAG
GTGCAGTACGTGGAGATGGACACGCTGCTCGCGCAGTCGGACATCATCTC
GATCCACGCGCCGCTGCTCCCCGAGACGCACCACCTCATCAACGAGACGA
CGCTGGCCAAGATGAAGCGCGGCGTCCTGATCATCAACACGTCGCGCGGC
CCGCTCGTCGACACCAAGGCCCTCATTGAGGCGCTCAAGTCGGGCCAGGT
CGGCGCGTGCGGCCTCGACGTTGTCGAGGGCGAGAACGACTACTTTTACG
AGAACTGCAGCGACTCGGTGGTGACCAACGAACAGCTCGCCCATCTCCTC
TCGTTCCAGAACGC
    




The gene BeE120N03E01 is related to E120-NOR-03-E01-U.BIN ():

Sequence ID Image
E120-NOR-03-E01-U.BIN
No Image