Blastocladiella emersonii clone report

Clone ID BeE120N03A09
Best BLASTX Match emb|CAB81424.1|
Function Description putative protein [Arabidopsis thaliana]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N03A09
GGGATCGACTCACACGTGCGCACAATCACCTCACGCTGCGCAACTTTGTC
GTGTCCAAGTCGTTCCAGGGCCGCACCGGGCCCGCGTTTCTCGTCACCAA
GCTCTCGAACGTGGTCCTCGGCACCGCCGAGTCGCGCCTGCTCATGACGG
GCCACCACGTCGTCGCGGACGTGAGCTGCGTCGTGTGCGGCGAGGTGCTC
GGCTGGAAATACCTCGAGGCCGCCGAGCTCGCGCAGCGGTACAAGGAGAA
CAAGTACATTGTTGAAAAGTCCAAGATCTGCCGCGCGCGCGCGAGCTCGC
CGCCGTCGCCGCCCACAAGCGCGCCCAACGAGGCCCGCGGCACCGTGTTC
GCGCGGATCCCGCTCGTCACGTCGCTCATCACGGACCACTGAGGTGCGCG
TCGTGTCGTGCCCACGGAGCCAGAGCGTTGAATGTAAATACAAACCGCCC
ATACCCTGACCAATACCGCCGAACACTGC
    




The gene BeE120N03A09 is related to E120-NOR-03-A09-U.BIN ():

Sequence ID Image
E120-NOR-03-A09-U.BIN
No Image