Blastocladiella emersonii clone report

Clone ID BeE120N02G12
Best BLASTX Match ref|XP_659097.1|
Function Description hypothetical protein AN1493.2 [Aspergillus nidulans FGSC A4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N02G12
GCATCATTCACCATGAAGTCGTTCGTCACCCTCGCGACCCTCGCCGCCCT
CGCCGCCATCCTGTCGGCCGGCTCGCAGCCCGCCTCGGCGCAGACGGCGG
CCCAGATCAACGCCACGGCCAAGGCCACGCGCGTCGGGTGGTGCCAGCTC
CAAGTCGCCATGTGCTCGAACGTCTGCGCGGCCAAGACCCAGACCAACGT
GTGCGACGTCGGCAGCCTCGCCTTCGCCTGCGTGTGCGGCAACGGCACGC
GCATCGACTTTACCAACTCGGTTGACCTCACCATCCCGTACTTCACCTGC
ATCACGTACCAGTGGCAGCCGTGCGTCAACGCGTGCCCGGCCGGCGACCA
GAAGTGCGCCGACACGTGCAACGCCCAGTTCGTGTGCGGCAAGGTCAAGG
CCGACCCGAACGCGACCGTGGCCATCACCGCCGCGTCCAAGACGTCCGGC
TCGGGCTCCGGGTCCAACGGCGGCCAGCAGGCCACCAACCCGGCCATCAT
CGACTCGAGCAACGTCGAGGCTTCCAACAAGGGCGCCCTCACCAACGCCG
CCGCCGCGAACGCGAACCAGGGCGGGGCC
    




The gene BeE120N02G12 is related to E120-NOR-02-G12-U.BIN ():

Sequence ID Image
E120-NOR-02-G12-U.BIN
No Image