Blastocladiella emersonii clone report

Clone ID BeE120N02G09
Best BLASTX Match ref|XP_397234.2|
Function Description PREDICTED: similar to WD repeat domain 34 [Apis mellifera]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N02G09
GTTCTCGCCTACTCGGTCGGTCACCAGTCAGGCGCCGCAGAAGCCGTGGG
CTCACCGTGGTGCACGCACGCCGGCATGGTTTCCGTGTGGCAGGGCGGCA
AAAAGACGGCGCGCGTGACGCTAGCGTCGTGCGCCACGTCCGTCGCGTTC
CACCCGGACCAGCCGTCCATCGTCGCGATCGGCATGTGGCCGGGCGACGT
GGCCGTGTGGGACACCAACACCGAGTCGCTCGTCTCGGCCGTGTCCGAGC
ACAGCCACGGCGACGCGGTCGGGCAGGTCGCGTGGCACGCGGGTAACCTG
TGGACCTGTGGCCTGGACGGCGCCATTACGGAATGGCGCTGGCGGCAAAA
GGCGCTCGAGCCGCTGCGCAAGGTCGTGCTCGCCATCTCGTCGCGGACCA
AGCTCGGCATCCCGCTGCGCGCGCTCGCGCTGCACCCTGACCCCGTCTCG
AGCATCCTCGTCGCGTCGAGCGTCGTCGGCGACCTCGTGCACATGGACAC
GCGCCGCATCAAGGCGTACGGGTCCACGCTCGCGGCGGGCCCAACGGCCG
CGCACTTTCGTTACTCGGGCCACGCGGGCGCCGTCGCGTACCTCGGCTTC
AACTCGCACGTCCCGCTGCTCCTCTCGGCAGGCCACGACAAGCGCATCAA
CCTGTTACGCGTCTTCCGCGA
    




The gene BeE120N02G09 is related to E120-NOR-02-G09-U.BIN ():

Sequence ID Image
E120-NOR-02-G09-U.BIN
No Image