Blastocladiella emersonii clone report

Clone ID BeE120N02F12
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N02F12
GGATTGAACCCGACCCGAACGCCCTGCCTGCCACTCCTGTCAACGCGTCC
AGTCGCGTCCACCGCGCCGCGCCTCGCCTCGCTCGCTGCTGCTCCTCTCT
TGCTCGGAAAGCAGACGCCCACATGATCGCCCATGAATGAAGAAAAAACT
TCTTGC
    




The gene BeE120N02F12 is related to E120-NOR-02-F12-U.BIN ():

Sequence ID Image
E120-NOR-02-F12-U.BIN
No Image