Blastocladiella emersonii clone report

Clone ID BeE120N02E05
Best BLASTX Match ref|XP_756164.1|
Function Description hypothetical protein UM00017.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N02E05
CACGGCGTGCTTCGCCACGGCCCTGCTCGACCGCCCCGCCGCCGAGTCGC
TCGCCGACCTGCACCCGCGCCAGCTCGCCGCCGCCGCCCTGTCGCTCGTG
TGGTGCTCGCGCCTCGGCCTGTTCCTGTTCCGCCGCGTGCGCCGCGCCGG
CCACGACCACCGCTTCGACGACATCAAGACCTCGCCCGTCCGCTTCCTCT
TCGCCTTCACCGCACAGACCGCCTGGGTCTGGTTCACCGGCCTCGCCGTC
TACATTGTCGCCACCAACCCCGCCTCGCGCATGCCCGACCTCAACGCCCT
CGACGCCGTCGGCGCTGCCGTCTGGGTCGCCGGGTTCGCCATCGAGACCA
TTGCCGACCACCAGAAGAACACCTTCAAGAACGCCAACCCGTCCAAGTTC
ATCACCTCGGGCCTCTGGGCCTACTCGCGCCACCCCAACTACTTCGGCGA
GGTCACCCTCTGGTACGGCATGTTCCTGCTGTGCGCCAGCGGCTTTGTCG
ACGCCTGGAACTGGGTCGCCGTGGCTCTCCCCGGTCTTTGTCACCCTGCT
CCTCTACTTTGGCTCGGGCGTCCCGCC
    




The gene BeE120N02E05 is related to E120-NOR-02-E05-U.BIN ():

Sequence ID Image
E120-NOR-02-E05-U.BIN
No Image