Blastocladiella emersonii clone report

Clone ID BeE120N02A03
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N02A03
AGGACGCGTGGGCGCAACCTCGAGTCGGGCGCGCTGCACAAGTACGGGTT
CCAGACGGCGTCGGCGGTCAAGATCCCCAAGAAGGCCAAGCTCGTGCGCT
TCTACGCGCAGGTGCGGTTCCGCGAGGGCAAGGAGGCGGCGGCGGCCTCG
GGCACGACCCCCGCCAAGAAGTGCGCCGTCAAGCACGCGGCCGTGTCGTT
CTACTACGGGTCGCGCCGC
    




The gene BeE120N02A03 is related to E120-NOR-02-A03-U.BIN ():

Sequence ID Image
E120-NOR-02-A03-U.BIN
No Image