Blastocladiella emersonii clone report

Clone ID BeE120N01G06
Best BLASTX Match gb|AAB71697.1|
Function Description chitin synthase [Filobasidiella neoformans]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N01G06
ATTGGCTGGATGCTCGTGCACATCCTCGCCATGCCCGTCTTCTACATGTA
CATTCCGCTGTACTCGTTCTGGCACTTTGACGACTTCAGTTGGGGCGCGA
CCCGCCGTATCGAGGGCGACAGCGGCAAGGGCGGGCACGACGGCGACAAC
GAGCTCTTCGACCCGTCGACGATCCCGACGGCCAAGTGGGACGACTACAA
GCGGGTGAAGCGGACCGAGGCGTCGCTCGACGCGACCAAGGCGTCCATGG
ACAACCT
    




The gene BeE120N01G06 is related to E120-NOR-01-G06-U.AB1 ():

Sequence ID Image
E120-NOR-01-G06-U.AB1
No Image