Blastocladiella emersonii clone report

Clone ID BeE120N01F03
Best BLASTX Match ref|XP_762492.1|
Function Description hypothetical protein UM06345.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N01F03
CGACCGGCGACGGATCGACGCCCACTTGTTGCAATGCTACGCTCTACCAT
GAATCCGCTGCTGCGCGCCGCCGCCGCCGCGGGCCGCCGCACCCTCGCCA
CGGCCCAGGTGTTTGCCTCGCGCCCGACGTCTGCGCCGCTCGTGGACGGG
TTCCCCGGCGCTGTGGGTAACACGCCTCTGATCCGGCTCAAGTCCTTCTC
CAAGTCGACCGGGTGCGAGATCCTGGTCAAGGCCGAGTTCATGAACCCGG
GCGGGTCCGTCAAGGACCGTGCGGCGCTCTGGGTCGTGCAGGACGCCGAG
AACCGCGGTCTGCTCTCGCCCGGCGGCACCGTGGTCGAGGGCACCGCGGG
CAACACGGGGATCGGGCTCGCGCACGTGTGCCGCGCGCGCGGGTACAAGT
GCGTCATCTACATGCCCAACAACCAGTCGCAGGAGAAGATCGACACACTG
CGGATGCTGGGCGCCGAGGTACACACGGTCCCCCGGAAGCCCTTCACGGA
C
    




The gene BeE120N01F03 is related to E120-NOR-01-F03-U.AB1 ():

Sequence ID Image
E120-NOR-01-F03-U.AB1
No Image