Blastocladiella emersonii clone report

Clone ID BeE120N01E04
Best BLASTX Match ref|XP_504136.1|
Function Description hypothetical protein [Yarrowia lipolytica]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N01E04
GCTACTTGCTGCAAAGCACCCGCCGAATTTATTTATCATCCACGATGCAG
GCCGCTATTGTCCGCGCAGCAACCACCGTGGCCCCGCGCACGCGCAAGGC
CGTGCTCACGCTGACACCACGCGCCGTGGAGCGCGTCAAGGACCTCGCCA
AGGAGGACTCGATTCTCCGCGTCGGCGTCAAGAAGAAGGGCTGCTCCGGC
CTCCAGTACTCGCTCGACTACGTCAAGGCGAAGCAGCGGTTTGACGAGGA
GGTGGTGCAGGACGGCGCGCGCGTACTCATCGAGTCCAAGGCGCTGCTGT
CGATTCTCGGTTCCGAGATGGACTACGTGCAGGACAAGCTGTCGTCGCAG
TTTGTGTTCAGCAACCCGAACGTCAAGGAGAGCTGCGGGTGCGGCCAGAG
CTTCATGGTGTAGCGAAGCCCTCTCGACTTCCTCCTTGCGTGCTCCTCCT
CAACCGTTCCCTCTCCCTCCCGTCCCTCGTTTTGCTTTGTACTATTCTCC
TCCTCCTAGCCCCCCCTTGCGCGCACCGCCGGTCGCTACCGCCGGTCGCT
ACCGCCTCCCTCGCCTGATATCCCATGCCCTGTA
    




The gene BeE120N01E04 is related to E120-NOR-01-E04-U.AB1 ():

Sequence ID Image
E120-NOR-01-E04-U.AB1
No Image