Blastocladiella emersonii clone report

Clone ID BeE120N01D10
Best BLASTX Match ref|XP_782220.1|
Function Description PREDICTED: similar to cytochrome P450, family 2, subfamily J, polypeptide 2 [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N01D10
CAGGCCAAGGCGCACGCCGAGCTCGACTTGCTGCGCGACGCGCACGGCAA
GCCGCGGCTGCCGGGGCTCGAGGACATGGATGCGCTGCCGTACACGCGCG
CCATCATCAAGGAGGTGCTGCGCGGCGTGCCCGTGGGCCCGCTCGGCCTG
CCGCGCATGACGACCGAGGACACGGAGGTCGGCGGGTACGCGGTGCCGAA
CGGGACCCAGGTCATCTTCGACATCGTGAGCATCCACGACAGCATGTACC
CGGGCGCCGGGACCGAGTTCAAGCCGGAGCGGTGGCTCGCCGGAGGCAAG
GGCGACGCCAAGGCCAACCTCGAGATCCCCGACGGGCTGTACACGTTCGG
CCAGGGCCGCCGGCTGTGCCCCGGGTTCCACCTCGCGTACCGCGAGCTGT
TCCTCGTCACGTCGACGATGCTCGCCGCGTTCGAGCTGCGCAGCGGCGAC
CCCGAACGCAAGACGCTCCGCATGGACGAGGCGTNTGGGCTCACGGTGCT
CCCCAAGCACGGCGTGCCCGTGCAGTTTGTGCCGCGCGGCAAGGTCGAGT
GGGCC
    




The gene BeE120N01D10 is related to E120-NOR-01-D10-U.AB1 ():

Sequence ID Image
E120-NOR-01-D10-U.AB1
No Image