Blastocladiella emersonii clone report

Clone ID BeE120N01B06
Best BLASTX Match ref|XP_384643.1|
Function Description hypothetical protein FG04467.1 [Gibberella zeae PH-1]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N01B06
GTACGCGTGGGCTCGCCGACTGCGACGCAGCTCCACGCAACGAAACTTGC
CGCAACGGATCCAGCCGCCCTCGCCACCATGACCCTCGACGTGAGCGACG
TGACCGTGGCCCCGCCTGCCATGAAGGTGACGCAAAAGGAGATGGCCGAC
GCTCGCGTCCCGCGCATCTACCGCGACTACTGCGCCCACCTGTGGATCCC
ACTCGAGAAGTGCCGCCGCGAGAACCTCTTCGCCCCATGGAAGTGCGGAG
ACGAGCGCCACGGCTACGAGGAGTGCCAGTACCGCGAGTACGTGCGCCGT
ATGAAGATTGCCGAGCTCAAGCGCCGCGAGCAGGACGATGCGTGAGCCCG
CTCGCCCTTGTAACGTCGGCATTTCCGAGCACACCTCGCTTCTGGATTCT
GCCCTCATTTGCTGTACCGTTGCCGACATTCCTACCACACCTTCCGTCAT
TCCAAGCCCCTCCGGCAACCACGGTTAATACACTGGTTGACCATTCCANN
NNANANNAANNNNNNNN
    




The gene BeE120N01B06 is related to E120-NOR-01-B06-U.AB1 ():

Sequence ID Image
E120-NOR-01-B06-U.AB1
No Image