Blastocladiella emersonii clone report

Clone ID BeCSAS2592
Best BLASTX Match ref|XP_787000.1|
Function Description PREDICTED: similar to programmed cell death 6 (1F340), partial [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2592
GCGTCCGCGAACATACGCAACTTCTCGCAATCATGGCTACCCGTCCCCCT
CCGCCCGGCGCCGACCCGAACCTCTGGGCCTGGTTCGTCGCCACAGACAC
GGACGGCAGCGGCAGTATCACCGCGCAGGAGCTCAAGCAGATGCTGCTGA
GCGCCCAAGGTGTACCCTACAATGACGAGACTGTTCGTCTCATGGTTGGC
ATGTTCGATCAGGACCACTCGGGCACCATCAACTTCAACGAGTTTGCCCA
GCTGTGGGGTTACCTCCACCAGTGGTCGACCTGCTTCCGCTCGTTTGACA
CGGACCGCAGTGGCTCGATTGACCCCTCCGAGCTCGAGAAGGCCTTCCTC
ACCTTCGGCTACCGCCTCAACCCCGACCTCATCCGCCTGCTCATCCGCAA
GTACGACCGTCAAGGTATCGGCGCCATCCCGCTCGACGCCTTCATCCAGT
GCTGCGTCACGGTCCAGACCCTCACCAACAGCTTCCGTCGCTTCGACACC
AGCGGCACCGGCTGGATCAACCTCGACTACCACTCGTTCCTCAACCTCGT
CCTGTCGAACCGCTAATCAGGACGTTTTCGCCGAGGGCTCGGCCTCGCCA
CGCGCCGAGTCCGAAAGCAGCTGCCGCGAGTGTACCCTTTGTTCGTGTCA
TCTCCCTCTCGTTTGTTGTTTACCGTCGCCATGACCCGCTCCTCCGCGGG
TCGCGCGAATACACGCTTTCTTCTCCCT