Blastocladiella emersonii clone report

Clone ID BeCSAS2589
Best BLASTX Match ref|XP_386211.1|
Function Description hypothetical protein FG06035.1 [Gibberella zeae PH-1]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2589
CTCTGCCTCGCGACCTTGCCTCTAAAGCTGTCCTGCACCAGCGCACGGAA
CGGCCACACGCACTCGCTGCAACGCATCAACACCTGCTCTATACACGTGC
GCGCGCCGAGTGACCGAACGAACGCGCCTGCGCCACCACCACCCGAATTC
GCGCCACACCTCCTCGAAATCACCATGGCGACCATGAACCTGCCCAAGAC
GGCGCTCAGCGGCTACGTCGGGTTCGACACGATCACGCAGCAGATTGAGC
GCAAGCTGCTGCGGCGCGGGTTCGCCTTCAACGTGATGCTGGTGGGCGCG
ACGGGGCTCGGCAAGTCGACGCTGCTCAACACGCTGTTTGCCGCGCACCT
CATCGACTCCAAGGGCCGCACGCGCGCCAACGAGCCGCCGCGCCAGACCA
CCGAGATCGCGCCCGTCACCCACAACATCGAGGAGAACGGCGTGCGCCTC
AAGCTGACCGTCGTCGACACGCCCGGCTACGGCGACCTCATGAACAACGA
GCACTGCCTCGACCCGATCCTCAAGTACATCAAGGACCAGTACGCGCACT
ACCTGCGCAAGGAGCTGACCGCCGCGCGCGACCGCCACATCTCCGACACG
CGTGTGCACTGCGTGCTCTTCTTCATCAACCCGTCGGGCCAGTCGCTCAA
GCCGCTCGACATTGTGGCGCTGCGCCAGCTGTTCCGAGATCTG