Blastocladiella emersonii clone report

Clone ID BeCSAS2588
Best BLASTX Match gb|AAX86984.1|
Function Description ERp57 [Cercopithecus aethiops]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2588
CCAAATGCAGCCCATCGCAACCATGAAGCACCTGCGCCCGTCGTTCCTCG
CGCTCCTCGTCGCGCTACTCGCCGCCGTCGCGTGCATGACCGCTTCGGCC
GCCAAGGAGACGCCGGCGCCCGGTTCCGCCGTGTCCCCGGCCCCCGTACT
GGAGCTCGCCGCGGGCAACTTCACGTCGGCCGTCAACGACGGCACCACCA
TGGTCTTCTTCTACGCCCCGTGGTGCCCGCACTGCAAGCGCGCCGCGCCC
GCGCTCCGCAACTTTGCCCGCAAGACCAAGGCCATCCAGAAGAAGCACGG
GTTCAAGGTCGCCATGATCAACTGTGAGGCCAACGAGGGTGCGTACGCTC
TGTCTAGGTGGTGAGCGTGTCGCTGACGCTTGGCACCCGATATAGCGACG
TGCGACGCACACAACATCGACGGGTTCCCGACCTACCTCGTGTTCCAGC