Blastocladiella emersonii clone report

Clone ID BeCSAS2587
Best BLASTX Match gb|EAA09679.2|
Function Description ENSANGP00000012649 [Anopheles gambiae str. PEST]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2587
CACAGGCCTCGGCCGAGACGGGTACCGAGGACGATGCAGCGCCCGCCGCC
GAGGAGGGCCTCGAGGTTGACCTGGCCCTGCTGCTCTCGCTCGACCGCGT
GCTGAACCCGCCCCCGCGCCCGGCCATCGCGTCGCACCCGCACATCCCGA
CGCATCTCCCCGCACTCCCCGGCTCCTCGGCGTTCGCCTCGGCCGCCGAC
ACGGCGGGCTCGAACCTCCTGCGCAGCGCCTCGTCCAAACCGGGCGCCTC
GTCGTCGACGGGCACCGCAGCGTGGGCCACCACCGTGCAACCGCCATCGC
CCAAGCGACGAAAGTTTGGCTCCTCTTCCGATACCCCAACCTCCACCCCG
CTCGACCGCAAGGCGCTCCTCGAGATGCACCGCAAGGGCCACCGCGTGCC
CCGGCCCGAGCGCGCCAACGCGGCGCTCAACGGCCACGCGGTCCCGCCGT
CGCGCCCGAACCCGAACCCGTCCGCGTACCTGCGCAAGGCCAAGCCGGGG
GCTGCCGCGGCAGCAGGGTCCAAACCGTCGTCGCTCGCGCGCGCCATTGC
TGCTGCCAACCGCGCGAGCGCCGCGGTCCCGGCCCCAACCCCGCCATCGT
CGGCCACAGGCGTCGGGACCGCCAACGCCGTGCCAGCGCCCGCCAAGCCT
GCGGCAGGAGCAGCAGCCGCGAGCGCGTGGAACCCAGCGGCGGGCACGAG
CACGTCGGTCCTGCGCCTGCTGCACCGGAAACCTGTCTCGCTCGCGACCG
CGCCCGACGCGCTCTTCACACGTGGCGACGGCGGCGAGCTCGACCCGCTC
CTCCCGAACCTGGCGCTGGTCGCCTCGTCGACGTCGGCCGAGGACCCGCC
CGACGAGGACAACAAGGCCGGCACCGAGGAGATCCACTGCATCTGCGACC
AGGCGCGCGTCGACGACGCCGGGCTCATGGTCGCGTGCGACAGCTGCGGC
GTCTGGTTCCACGGCAAGTGCGTCCATATCACCGCCGCCATGGTCCACGA
CGGGCTCACGTGGTACTGCCCGCGGTGTATCAAGGCGGGCAAGCTGCACG
AGATCAAGGCCGCCGCC