Blastocladiella emersonii clone report

Clone ID BeCSAS2584
Best BLASTX Match emb|CAB56513.1|
Function Description putative thioredoxin-like protein [Mortierella alpina]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2584
CACGCGTCCGCGCAACGCAACGCAACGTATTACCAATGGCATCAACGACC
CCCAGCAACCTGCACGTCGCGACCGACGACGCCCACTTTGCGCAGCTCGT
CGGCGCGGGCGCCAAGTCGTCGGTCGCCGTGGCCAACTTCCACGCCGACT
GGGCGCCACAATGCGTGCAGATGAACGAGGTCTTCACCGAGCTCGCGCGC
CTGCACGCCAACGTCGACTTCATCATGGTCGAGGCCGAGGAGCTCGCCGA
CACGTCCGAGGCCCTCGACATTGCCGCCGTGCCGTCGTTTGTCGTGCTGC
GCGCCGGCAAGCCCGTCGACCGCGTCAACGGCGCCGACGCGCTCGAGCTG
ACCAACGTGGTCGAGAAGCACGCCAAGAACGCCAAGCTGCTCGTCAACGG
CGTCGCGGCCGGCACCGCGCCCGCGGGCACTGCCGCCGCCGCCGGTGGTG
CACCCGACGCGCCCGCGCTGACGCCGGCGGCCATGGAGGCGCGGCTCAAG
CAGCTGATCAACATGGCGCCCATGGTGCTGTTCATGAAGGGCACGCCGCA
GCAGCCGCGGTGCGGCTTCTCGCGCCAGACCATCGAGCTGCTGACCAAGT
ACGAGGCGCGGTACTCGACCTTCAACATCCTCGCCGACGAGCAGGTGCGC
CAGGCCCTCAAGGTCTTCTCCAACTGGCCAACGTACCCGCAGCAGTACAT
CAACGGCGAGCTGGTCGGCGGACTCGACATCCTCAAGGAGCTCGACGCCT
CGGGCGAGCTCGCCGACCTGATTCCCAAGGNAGGAGGACCNNTCACACCG
NCTCGNCAAGCTGACCAGCGCGCCGAC